Programa de Pós-Graduação em Ciências Farmacêuticas

Permanent URI for this communityhttps://repositorio.ufrn.br/handle/123456789/11920

Browse

Search Results

Now showing 1 - 10 of 21
  • Master Thesis
    Caracterização físico-química e propriedades bioativas do resíduo do cajá (Spondias mombin L.) fermentado com probióticos
    (Universidade Federal do Rio Grande do Norte, 2025-11-10) Vieira, Jordan Moura; Sousa Júnior, Francisco Canindé de; https://orcid.org/0000-0003-2042-4348; http://lattes.cnpq.br/3721560802857426; http://lattes.cnpq.br/7077119920725069; Damasceno, Karla Suzanne Florentino da Silva Chaves; Souza Filho, Pedro Ferreira de
    Probiotics are live microorganisms that, when administered in adequate amounts, confer health benefits. Combining probiotics and plant-based raw materials has emerged as a promising strategy, enabling the simultaneous delivery of beneficial microorganisms and bioactive compounds, such as fiber, phenolic compounds, and vitamins. Yellow mombin (Spondias mombin L.) is a fruit native to Brazil, mainly used in the production of ice cream and frozen pulp, with its seed being widely discarded as waste. In this context, the present study aimed to evaluate the physicochemical characteristics and bioactive potential of two culture media based on yellow mombin residue, with and without supplementation, and fermented by two probiotic strains, Lactiplantibacillus plantarum NRRL B-4496 and Saccharomyces boulardii 17. Physicochemical and bioactive characterization of the media and their fermented products included the assessment of probiotic viability, parameters related to acidity and nutritional factors, as well as the quantification of total phenolic compounds, total flavonoids, and ascorbic acid, complemented by individual phenolics compounds quantification. In vitro antioxidant activity was evaluated through assays involving the reduction and chelation of metal species, in addition to the elimination of radicals. Additionally, in vitro inhibition assays of α-amylase and amyloglucosidase, two enzymes involved in carbohydrate digestion, also were performed. The characterization of the media revealed an acidic character, and initially low in nutrients, while still representing an appreciable source of ascorbic acid and polyphenols, mainly phenolic acid compounds and flavonoids of the flavanol, flavanone, and flavonol types. All fermented media exhibited final probiotic viability ≥ 8 log CFU/mL, indicating the yellow mombin residue as a prebiotic subtract potential. Furthermore, fermentation modulated the levels of bioactive compounds, significantly altering antioxidant and enzyme inhibition activities. Therefore, the yellow mombin residue can be considered a viable matrix for fermentation with probiotic strains, demonstrating potential for the development of innovative functional products.
  • Master Thesis
    Avaliação toxicológica e efeito terapêutico do extrato hidroalcoólico de Momordica charantia na resposta inflamatória aguda induzida por lipopolissacarídeo (LPS)valiação toxicológica e efeito terapêutico do extrato hidroalcoólico de momordica charantia na resposta inflamatória aguda induzida por LIP
    (Universidade Federal do Rio Grande do Norte, 2025-12-03) Oliveira, Maria Lúcia de Azevedo; Almeida, Maria das Graças; Luz, Jefferson Romáryo Duarte da; https://orcid.org/0000-0002-5587-0922; http://lattes.cnpq.br/0321740024191482; http://lattes.cnpq.br/7563699257339457; Santos, Elizabeth Cristina Gomes dos; https://orcid.org/0000-0003-4912-8016; http://lattes.cnpq.br/6990029952181366; Souza, Gisele Custódio de; https://orcid.org/0000-0003-3553-3635; http://lattes.cnpq.br/8625340401893375; Silva, Marcelo de Sousa da; https://orcid.org/0000-0002-1000-0149; http://lattes.cnpq.br/1295430560645312
    Momordica charantia L. (Cucurbitaceae) has been widely recognized for its pharmacological potential, although studies on its leaves remain scarce. In this study, the hydroethanolic leaf extract (MCHLE) was chemically characterized by LC–MS/MS, revealing the presence of octopamine, ferulate, vitexin-2-O-rhamnoside, and other bioactive phenolics. Therefore, our work evaluated the anti-inflammatory potential of plant extracts from Momordica charantia in in vivo and in vitro models of LPS-induced peritonitis, also assessing the toxicological profile of the aqueous extract of the plant, with the aim of providing more scientific information to be used in clinical practice in the treatment of inflammation. Toxicological evaluation in Wistar rats demonstrated that both acute (2000 mg/kg) and repeated oral administration (up to 400 mg/kg for 28 days) caused no clinical or behavioral signs of toxicity, while maintaining normal hepatic and renal parameters. Notably, treatment significantly reduced glucose and cholesterol levels, in addition to attenuating lipid peroxidation and enhancing antioxidant defenses. In vivo, MCHLE inhibited leukocyte and neutrophil infiltration in the LPS-induced peritonitis model, with efficacy comparable to dexamethasone. It also reduced TNF-α secretion and nitric oxide generation in peritoneal fluids. In vitro assays with LPS-stimulated RAW 264.7 macrophages confirmed these effects, showing dose-dependent inhibition of TNF-α, IL-1β, and NO production. Gene expression analysis further demonstrated downregulation of TNF-α and MAPK, with marked suppression of NF-κB transcripts. Collectively, these results provide strong evidence that MCHLE exerts anti-inflammatory activity by targeting both mediator release and upstream signaling pathways, while maintaining a favorable safety profile, supporting its potential as a source of new therapeutic agents.
  • Master Thesis
    Desenvolvimento de formulações cosméticas contendo sistema multicomponente com ácido ferúlico: caracterização e ensaios in vitro de liberação cutânea
    (Universidade Federal do Rio Grande do Norte, 2025-09-18) Freire, Jamile Vitória Alves; Lima, Adley Antonini Neves de; Ostrosky, Elissa Arantes; Gomes, Ana Paula Barreto; Baby, André Rolim
    The cosmetic application of ferulic acid (FA) is limited due to its low solubility in aqueous medium and high susceptibility to oxidation. However, this phenolic compound is widely used because of its recognized antioxidant activity. To overcome these challenges, the multicomponent system Cicloferulic® (CF) was developed, containing FA, hydroxypropyl β-cyclodextrin (HP-β-CD), and polyvinylpyrrolidone K30 (PVP K30), using the kneading method. The system was characterized in terms of physicochemical aspects by DSC and TG/DTG, which showed greater thermal stability of CF compared to isolated FA. FTIR, SEM, and XRD analyses revealed molecular interactions suggesting the formation of the system and the transition from the crystalline to the amorphous state. In in vitro cytotoxicity tests using the human keratinocyte cell line (HaCaT), FA was safe up to a concentration of 500 µg/mL, while CF maintained cell viability above 80% up to 10,000 µg/mL. The quantification of FA content incorporated into the system was performed by UPLC, showing high incorporation efficiency and a yield of 92%. In the antioxidant activity assay in HaCaT cells, FA and CF showed similar activity at low concentrations; however, at higher concentrations, FA exerted a pro-oxidant effect, while CF maintained high antioxidant potential. In the DPPH, ABTS, and CAT methods, CF showed higher antioxidant activity than isolated FA, but in cosmetic formulations such as gel and emulsion, the efficacy was reduced, possibly due to interactions of the complex with the aqueous vehicle. The presence of FA and CF increased the SPF of formulations containing organic UV filters, and the increase was observed similarly even in the formulation with a lower concentration of UV filters; however, the formulations did not remain photostable after irradiation. In in vitro skin release studies, formulations with isolated FA showed greater and faster release, whereas CF promoted slower and modified release, indicating that complexation of the active ingredient and the formulation modulate the availability and flux of FA. Cicloferulic® proved to be a promising strategy to improve the limitations of FA, offering safety, high antioxidant activity, increased SPF, and the possibility of modified release of the cosmetic active ingredient.
  • Master Thesis
    Peptídeos análogos do TsAP-2: caracterização estrutural, atividade antimicrobiana e associação com fármacos convencionais
    (Universidade Federal do Rio Grande do Norte, 2025-10-29) Braz, Raiça Dominique Mariana Gomes da Costa; Pedrosa, Matheus de Freitas Fernandes; Inaoka, Daniel Ken; Silva, Teresinha Gonçalves da
    The growing resistance of pathogens to conventional antimicrobial agents represents a grave public health issue of global scale. Considering the situation, the need for new therapeutic alternatives is evident. The development of synthetic analogs based on antimicrobial peptides (AMPs) found in nature is a demonstrably promising option. TsAP-A16 and TsAP-A41 are synthetic analogs of TsAP-2, an AMP identified in the venom of the Tityus serrulatus and the Tityus stigmurus scorpions. In vitro and in vivo, TsAP-2 has shown antimicrobial activity against Gram-positive bacteria and Candida spp. yeasts. TsAP-A16 and TsAP-A41 were designed through single replacements on the primary structure of TsAP-2, aiming to obtain molecules more potent than the native peptide. This study focuses on elucidating physicochemical and structural aspects of TsAP-A16 and TsAP-A41, as well as assessing the antimicrobial activity of the peptides in isolation and in combination with conventional drugs, seeking to appraise the potential contributions of TsAP-A16 and TsAP-A41 to the issue of antimicrobial resistance. Bioinformatic tools and in vitro methods were employed in the evaluation of physicochemical characteristics and biological activities of the peptides. In silico data indicate TsAP-A16 and TsAP-A41 as molecules with structural similarities to TsAP-2, but with greater affinity for the Gram-positive and Gram-negative membranes, as demonstrated by molecular dynamics simulations’ results. The analog peptides were obtained through solid phase peptide synthesis prior to investigation of biological activities. In vitro, the analogs demonstrated broadened action spectrum in comparison to TsAP-2, acting not only against Candida spp. and Gram-positive bacteria but Gram-negative strains as well. Preliminary assessment of antifungal molecular mechanisms against Candida albicans revealed affinity of the analog peptides for ergosterol and indifference toward sorbitol, suggesting interactions with components of the fungal cell membrane, but not with the cell wall. Associating the analogs with conventional antibiotics before Staphylococcus aureus e Pseudomonas aeruginosa revealed synergism in combinations with gentamicin, and additive effect in combinations with ceftazidime and penicillin. Assays with murine fibroblasts and human red blood cells indicated concentration-dependent compatibility between the analogs and healthy eukaryotic cells. Furthermore, in silico predictions of the pharmacokinetic and toxicological profiles suggested that the analogs would be well tolerated by the human organism. The data obtained in silico and in vitro corroborate the usefulness of the rational design of molecules derived from scorpion peptides, indicating the peptides TsAP-A16 and TsAP-A41 as promising candidates for the development of new antimicrobial agents.
  • Master Thesis
    Contribuição ao uso do óleo de urucum no desenvolvimento de fitomedicamentos: avaliação da toxicidade oral aguda do óleo de urucum e caracterização de géis de carbopol contendo nanocarreadores lipídicos e a fração insaponificável de urucum
    (Universidade Federal do Rio Grande do Norte, 2025-10-30) Bastos, Ana Clara Almeida Santiago; Moura, Túlio Flávio Accioly de Lima e; Rezende, Adriana Augusto de; https://orcid.org/0000-0003-2452-4047; http://lattes.cnpq.br/4245215108740331; http://lattes.cnpq.br/4452581275123481; http://lattes.cnpq.br/8614594182690096; Bezerra, João Felipe; https://orcid.org/0000-0002-9978-628X; http://lattes.cnpq.br/7464620984028550; Ferreira, Leandro De Santis; https://orcid.org/0000-0002-8408-5886; http://lattes.cnpq.br/6622861873027635
    Bixa orellana L. (urucum) has been highlighted in research aiming to develop herbal medicines due to its wound-healing properties, mainly attributed to various compounds with antiinflammatory and antioxidant action, which favor tissue regeneration. With a view to contributing to the safety of future patients, this work evaluated the acute oral toxicity of formulations with nanoencapsulated urucum oil in Nanostructured Lipid Carriers (NLCs). Additionally, carbopol-based gels containing the NLCs with the unsaponifiable fraction of encapsulated urucum were developed for possible topical application. No behavioral, hematological, or biochemical changes, nor changes in body or organ weights, were found in acute oral toxicity tests in Wistar rats at a dose of 2000mg/kg of the oil. The NLC formulations showed average particle sizes between 106 and 161 nm, a Polydispersity Index (PDI) lower than 0.2, and a zeta potential up to -18 mV, indicating good stability for 90 days. HPLC analysis indicated the presence of tocotrienol in the unsaponifiable fraction of urucum, with a coefficient of determination (R²) of 0.9997, highlighting the adequacy of the model for quantifying the compound in the sample. The formulated hydrogels showed a stable appearance, skincompatible pH, and excellent spreadability, especially in formulations with the unsaponifiable fraction of urucum. Through the collected data, it was possible to confirm that the formulations are safe, stable, and promising for pharmaceutical use, with emphasis on potential topical and wound-healing applications.
  • Master Thesis
    Obtenção, caracterização físico-química e avaliação biológica in vitro de dispersões sólidas amorfas com a,B-amirenona
    (Universidade Federal do Rio Grande do Norte, 2024-12-13) Bulhões, Sávio Gorgônio Paes de; Lima, Adley Antonini Neves de; https://orcid.org/0000-0002-3798-3915; http://lattes.cnpq.br/4061809277935577; http://lattes.cnpq.br/3969304016037186; Duarte, Fernanda Ílary Costa; https://orcid.org/0000-0003-2052-9334; http://lattes.cnpq.br/3035470083983748; Rocha, Hugo Alexandre de Oliveira; https://orcid.org/0000-0003-2252-1221; http://lattes.cnpq.br/4651814546820796
    Obesity is a global public health issue, associated with diets high in fats and carbohydrates, as well as sedentary lifestyles, affecting approximately 25% of the Brazilian population, especially women. Lifestyle changes are the conventional treatment but face adherence challenges, leading to an increased search for medications and surgeries, which come with adverse effects. Triterpenes, such as α,βamirenone (ABAME), have shown antiobesity potential, but their poor water solubility limits their oral effectiveness. To overcome this limitation, solid dispersions (SD) of ABAME were prepared with the polymers PEG and PVP using malaxation (MX) and physical mixing (MF) techniques, aiming to improve solubility and pharmacological properties. The samples were characterized by techniques such as Differential Scanning Calorimetry (DSC), Thermogravimetric Analysis (TG), X-ray Diffraction (XRD), Fourier Transform Infrared Spectroscopy (FTIR), and Scanning Electron Microscopy (SEM), indicating that the interaction between ABAME and the polymers promoted a transition from the crystalline to the amorphous state, as well as greater thermal stability compared to the isolated compound, particularly in the SDs obtained by MX. The quantification of ABAME was performed by High-Performance Liquid Chromatography (HPLC), meeting ANVISA standards and demonstrating success in SD development. In in vitro biological tests, the SDs showed greater efficacy in lipase inhibition compared to isolated ABAME, especially those prepared by MX, with a reduced IC50. Although antioxidant tests showed moderate results, with lower performance in total antioxidant capacity (TAC) and DPPH radical scavenging assessments, the SDs demonstrated excellent reducing power. The data, though preliminary, highlight the antiobesity potential of the SDs, marking them as a promising strategy compared to conventional treatments, which often present adverse effects.
  • Master Thesis
    Revisão sistemática do potencial efeito da Passiflora edulis no diabetes mellitus
    (Universidade Federal do Rio Grande do Norte, 2025-07-29) Farias, Luiz Ricardo Teixeira de; Langassner, Silvana Maria Zucolotto; Tavares, Emanuella de Aragão; https://orcid.org/0000-0003-4823-0211; http://lattes.cnpq.br/9967017709735330; https://orcid.org/0000-0002-2768-0793; http://lattes.cnpq.br/7390416147619446; http://lattes.cnpq.br/7649718928075032; Oliveira, Alisson Macário de; https://orcid.org/0000-0003-4152-150X; http://lattes.cnpq.br/1391628714654744; Costa, Geison Modesti; http://lattes.cnpq.br/8830889545657806
    Diabetes mellitus (DM) is a chronic metabolic disorder of high global prevalence, characterized by hyperglycemia resulting from deficiency in insulin production or action, a condition that leads to progressive dysfunctions in target organs, such as the heart, kidneys, eyes, blood vessels and nervous system. Despite the efficiency of available pharmacological treatments, their adverse effects and therapeutic limitations have driven the search for safe and natural alternatives. In this context, the species Passiflora edulis, widely cultivated in Brazil and traditionally used for the sedative properties of its leaves, has aroused interest regarding the antidiabetic potential of its by-products, especially the peels and seeds, generally discarded by the food industry. This systematic review aimed to evaluate the available in vivo preclinical evidence on the effects of P. edulis in the management of DM. The search was conducted according to the PRISMA guidelines, in the PubMed, Embase and Web of Science databases, and the protocol was registered in the PROSPERO platform (CRD42023472406). Experimental studies with diabetic animal models treated with different preparations of P. edulis were included, and the risk of bias assessment was performed using the SYRCLE RoB tool. Of the 22 eligible studies, 18 reported significant reduction in glycemia, with reductions of up to 71% in glucose levels, both alone and as an adjuvant to insulin. Consistent effects on the modulation of the lipid profile and antioxidant activity were also observed. The barks were the most investigated part of the plant (11 studies), with emphasis on the aqueous extract, whose superiority is attributed to the higher content of bioactive compounds such as pectin, phenols and flavonoids. The proposed mechanisms of action include the reduction of intestinal glucose absorption, stimulation of insulin secretion, partial regeneration of pancreatic β-cells, and activation of relevant metabolic pathways such as PI3K/AKT and AMPK, in addition to antioxidant and hypolipidemic effects. However, important methodological limitations were identified, such as the lack of standardization in the doses used and the scarcity of phytochemical characterization of the extracts, factors that compromise the reproducibility of the findings. Nevertheless, the data suggest that P. edulis barks, due to their high functional value and availability as agro-industrial waste, represent a promising, sustainable and low-cost alternative in the adjuvant treatment of diabetes mellitus and its complications.
  • Master Thesis
    O papel dos miRNAs na doença de Lyme: uma revisão
    (Universidade Federal do Rio Grande do Norte, 2025-06-10) Lavieri, Giovani Jardini; Silbiger, Vivian Nogueira; http://lattes.cnpq.br/6121935907512568; http://lattes.cnpq.br/6121935907512568; http://lattes.cnpq.br/5688094051517300; Ururahy, Marcela Abbott Galvão; https://orcid.org/0000-0003-0229-9416; http://lattes.cnpq.br/8016222352823817; Duarte, Victor Hugo Rezende; https://orcid.org/0000-0002-3122-9073; http://lattes.cnpq.br/5892971598537293
    Introduction: Lyme disease (LD) is the most common tick-borne disease in North America and Europe. Caused by the bacterium Borrelia burgdorferi, it manifests itself in different forms and stages, and may be asymptomatic or with nonspecific symptoms, in addition to the difficulty in localizing the arachnid bite and the possible lack of formation of erythema migrans, which makes clinical diagnosis difficult. Current laboratory diagnostic methods have limitations, such as the absence of antibodies against bacteria during the first weeks of infection, in addition to access to samples, since Borrelia burgdorferi lodges in difficult-toaccess tissues. In this context, miRNAs emerge as potential candidates in understanding the pathophysiology of LD, as well as biomarkers and therapeutic targets, given their stability and ability to reflect pathological states, including bacterial infections. Objective: To conduct a narrative review on the role of miRNAs in LD. Methodology: The search was performed in PubMed, Embase, ScienceDirect, Web of Science and LILACS databases, using the terms "Lyme Disease", "Borrelia burgdorferi", "Lyme Borreliosis", "Lyme Arthritis", "Lyme Carditis" and "MicroRNA". Results: Of the 7 studies included, three were performed in vitro with different human cell cultures, two used in vivo models with mice, one study was performed in vitro with Ixodes scapularis ticks and one was observational with patient samples. Total RNA extraction methodologies varied between the TriZol method and the miRNeasy Kit and the analysis of miRNA expression varied from RNAseq to qRT-PCR. In total, 261 differently expressed miRNAs were analyzed among all studies and, of these, miR-146a-5p, miR-155, miR-145 and miR-146b were described in more than one study with increased expression in different samples and clinical manifestations. Conclusion: miRNAs such as miR-146a-5p, miR-155, miR-145, and miR-146b play important roles in the inflammatory regulation of LD, being involved in dermal manifestation, arthritis, carditis, and microglial activation. These miRNAs have potential as biomarkers and therapeutic targets in LD, although further studies are needed to validate their applicability in the diagnosis and treatment of the disease.
  • Doctoral Thesis
    Proteínas podocitárias como marcadores de estágios iniciais da doença renal diabética: estudo em modelo experimental induzido por estrepzotocina
    (Universidade Federal do Rio Grande do Norte, 2025-07-25) Gomes, Iago de Souza; Rezende, Adriana Augusto de; Ururahy, Marcela Abbott Galvão; https://orcid.org/0000-0003-0229-9416; http://lattes.cnpq.br/8016222352823817; https://orcid.org/0000-0003-2452-4047; http://lattes.cnpq.br/4245215108740331; http://lattes.cnpq.br/6311607612534067; Pedrosa, Matheus de Freitas Fernandes; http://lattes.cnpq.br/2929963416385218; Farias, Naisandra Bezerra da Silva; http://lattes.cnpq.br/6590909272236189; Freitas, Renata Caroline Costa de; http://lattes.cnpq.br/7118101315881678; Almeida Júnior, Renato Ferreira de; http://lattes.cnpq.br/9364791639345409
    Diabetic kidney disease (DKD) is a common complication of diabetes mellitus (DM), characterized by early podocyte loss and alterations in essential slit diaphragm proteins such as nephrin, podocin, and WT1. This study evaluated the mRNA expression of the Nphs1, Nphs2, and Wt1 genes in the renal cortex, as well as protein expression in renal tissue and urinary extracellular vesicles (uEVs), using an experimental model in Wistar rats divided into three groups: control (C), streptozotocin-induced diabetic (D), and insulin-treated diabetic (DT), followed for 60 days. Serum and urinary biochemical parameters, gene expression by RT-qPCR, and protein expression by Western blot were analyzed. After 60 days, insulin therapy promoted effective glycemic control, with a significant reduction in blood glucose (p < 0.001) and albuminuria (ACR; p = 0.036) compared to the D group, although still elevated relative to the control (p = 0.034). In diabetic groups, a significant increase in mRNA expression of the studied genes was observed (p = 0.001), whereas the corresponding proteins showed reduced expression in renal tissue (p = 0.021; 0.006; 0.004) and increased levels in uEVs (p = 0.034; 0.014; 0.004). Insulin therapy was not sufficient to fully prevent or control these alterations, showing a limited response compared to the D group, and still distinct from the control profile. These findings indicate that hyperglycemia induces a compensatory transcriptional response that does not prevent protein loss and increased excretion via uEVs, reflecting DKD progression, while insulin therapy partially mitigates these changes, underscoring the importance of glycemic control. Nephrin, podocin, and WT1, both in renal tissue and in uEVs, emerge as potential biomarkers for identifying early glomerular injury, even in T1DM patients apparently controlled by insulin therapy.
  • Master Thesis
    Identificação do Trypanosoma cruzi por amplificação do DNA com novos iniciadores na Reação em Cadeia da Polimerase (PCR)
    (Universidade Federal do Rio Grande do Norte, 2025-01-28) Sales, Leticia Mikardya Lima; Câmara, Antonia Cláudia Jácome da; Galvão, Lucia Maria da Cunha; https://orcid.org/0000-0002-6207-4502; http://lattes.cnpq.br/6437957961133013; https://orcid.org/0000-0001-7337-9320; http://lattes.cnpq.br/5445255186647578; https://orcid.org/0000-0002-9809-6658; http://lattes.cnpq.br/4167228218023419; Rodrigues Neto, João Firmino; http://lattes.cnpq.br/6168035663769198; Silva, Eliane Lages; http://lattes.cnpq.br/9387494555377448
    Chagas disease (CD) is a parasitic infection caused by the flagellated protozoan Trypanosoma cruzi. The diagnosis of the chronic phase of Chagas disease is performed mainly by serological tests, which detect specific anti-T. cruzi antibodies. However, inconclusive or false-positive results are recurrent, mainly due to crossreactions with other trypanosomatids. Thus, advances in molecular biology are responsible for significantly improving the diagnosis of the infection. The objective of this study was to identify T. cruzi from different Discrete Typing Units (DTUs) by DNA amplification with new primers in the Polymerase Chain Reaction (PCR). Primer design was based on DNA sequences of T. cruzi reference strains, clones and isolates deposited in NCBI GenBank for the kDNA genes: 18S, Cytochrome Oxidase subunit II (COX II), NADH dehydrogenase subunit 1 (NADH 1) and NADH dehydrogenase subunit 5 (NADH 5). Primers were designed in NCBI Primer-Blast. After manual checking and in silico testing, the most promising primers designed for the 18S gene (5’ – CAAGCGGCTGGGTGGTTATT – 3’ and 3’ – CACGGATTTCCCACAAAGGC – 5’) produced a 104bp fragment, COX II (5’ – TGTTATCCATTCATTTACGTTAGC – 3’ and 3’ – CATAACTCGCTGCATTGC – 5’) produced a 122bp fragment, NADH 1 (5’ – AAGTCCAGCAACCAATTCACTT – 3’ and 3’ – CGTTACTCTGTGATGGCTTGA – 5’) formed a 71bp band and NADH 5 (5’ – AGAGTACACAGTTTGGGTTG – 3’ and 3’ – CCACATACAACTAACGTTGC – 5’), which produced a 100bp band were selected for the study. Initially, the PCR conditions were tested for the four chosen primer pairs and the annealing temperatures were defined as 60ºC (18S), 48ºC (COX II), 57ºC (NADH 1) and 55ºC (NADH 5). Then, the analytical sensitivity test was performed with different DTUs, DNA concentrations and amount of the parasite in the blood. The primers designed for 18S detected the parasite at concentrations of 0.1fg to 1000fg in TcI (Col 1.7), 1fg to 1000fg for TcII (Y) and 10fg to 1000fg in TcIII (CBS56). The analytical sensitivity of the parasite concentration in the blood revealed that the 18S primers were able to detect T. cruzi DNA at concentrations of 1000p/mL in TcI and TcII samples; and from 10pmL to 1000p/mL in TcIII. The COXII PCR did not achieve adequate standardization. The primers used for the NADH 1 and NADH 5 PCR were not able to detect all the DTUs tested. The data presented here revealed that the identification of T. cruzi was not very efficient in human blood samples from domesticated animals such as Canis familiaris, Ovis aries and Capra hircus. Furthermore, parasite DNA was identified in all T. cruzi samples from cultures of intestinal contents of triatomines.