PPGCF - Mestrado em Ciências Farmacêuticas
Permanent URI for this collectionhttps://repositorio.ufrn.br/handle/123456789/11921
Browse
collection.page.browse.recent.head
Now showing 1 - 20 of 275
Master Thesis Caracterização físico-química e propriedades bioativas do resíduo do cajá (Spondias mombin L.) fermentado com probióticos(Universidade Federal do Rio Grande do Norte, 2025-11-10) Vieira, Jordan Moura; Sousa Júnior, Francisco Canindé de; https://orcid.org/0000-0003-2042-4348; http://lattes.cnpq.br/3721560802857426; http://lattes.cnpq.br/7077119920725069; Damasceno, Karla Suzanne Florentino da Silva Chaves; Souza Filho, Pedro Ferreira deProbiotics are live microorganisms that, when administered in adequate amounts, confer health benefits. Combining probiotics and plant-based raw materials has emerged as a promising strategy, enabling the simultaneous delivery of beneficial microorganisms and bioactive compounds, such as fiber, phenolic compounds, and vitamins. Yellow mombin (Spondias mombin L.) is a fruit native to Brazil, mainly used in the production of ice cream and frozen pulp, with its seed being widely discarded as waste. In this context, the present study aimed to evaluate the physicochemical characteristics and bioactive potential of two culture media based on yellow mombin residue, with and without supplementation, and fermented by two probiotic strains, Lactiplantibacillus plantarum NRRL B-4496 and Saccharomyces boulardii 17. Physicochemical and bioactive characterization of the media and their fermented products included the assessment of probiotic viability, parameters related to acidity and nutritional factors, as well as the quantification of total phenolic compounds, total flavonoids, and ascorbic acid, complemented by individual phenolics compounds quantification. In vitro antioxidant activity was evaluated through assays involving the reduction and chelation of metal species, in addition to the elimination of radicals. Additionally, in vitro inhibition assays of α-amylase and amyloglucosidase, two enzymes involved in carbohydrate digestion, also were performed. The characterization of the media revealed an acidic character, and initially low in nutrients, while still representing an appreciable source of ascorbic acid and polyphenols, mainly phenolic acid compounds and flavonoids of the flavanol, flavanone, and flavonol types. All fermented media exhibited final probiotic viability ≥ 8 log CFU/mL, indicating the yellow mombin residue as a prebiotic subtract potential. Furthermore, fermentation modulated the levels of bioactive compounds, significantly altering antioxidant and enzyme inhibition activities. Therefore, the yellow mombin residue can be considered a viable matrix for fermentation with probiotic strains, demonstrating potential for the development of innovative functional products.Master Thesis Avaliação toxicológica e efeito terapêutico do extrato hidroalcoólico de Momordica charantia na resposta inflamatória aguda induzida por lipopolissacarídeo (LPS)valiação toxicológica e efeito terapêutico do extrato hidroalcoólico de momordica charantia na resposta inflamatória aguda induzida por LIP(Universidade Federal do Rio Grande do Norte, 2025-12-03) Oliveira, Maria Lúcia de Azevedo; Almeida, Maria das Graças; Luz, Jefferson Romáryo Duarte da; https://orcid.org/0000-0002-5587-0922; http://lattes.cnpq.br/0321740024191482; http://lattes.cnpq.br/7563699257339457; Santos, Elizabeth Cristina Gomes dos; https://orcid.org/0000-0003-4912-8016; http://lattes.cnpq.br/6990029952181366; Souza, Gisele Custódio de; https://orcid.org/0000-0003-3553-3635; http://lattes.cnpq.br/8625340401893375; Silva, Marcelo de Sousa da; https://orcid.org/0000-0002-1000-0149; http://lattes.cnpq.br/1295430560645312Momordica charantia L. (Cucurbitaceae) has been widely recognized for its pharmacological potential, although studies on its leaves remain scarce. In this study, the hydroethanolic leaf extract (MCHLE) was chemically characterized by LC–MS/MS, revealing the presence of octopamine, ferulate, vitexin-2-O-rhamnoside, and other bioactive phenolics. Therefore, our work evaluated the anti-inflammatory potential of plant extracts from Momordica charantia in in vivo and in vitro models of LPS-induced peritonitis, also assessing the toxicological profile of the aqueous extract of the plant, with the aim of providing more scientific information to be used in clinical practice in the treatment of inflammation. Toxicological evaluation in Wistar rats demonstrated that both acute (2000 mg/kg) and repeated oral administration (up to 400 mg/kg for 28 days) caused no clinical or behavioral signs of toxicity, while maintaining normal hepatic and renal parameters. Notably, treatment significantly reduced glucose and cholesterol levels, in addition to attenuating lipid peroxidation and enhancing antioxidant defenses. In vivo, MCHLE inhibited leukocyte and neutrophil infiltration in the LPS-induced peritonitis model, with efficacy comparable to dexamethasone. It also reduced TNF-α secretion and nitric oxide generation in peritoneal fluids. In vitro assays with LPS-stimulated RAW 264.7 macrophages confirmed these effects, showing dose-dependent inhibition of TNF-α, IL-1β, and NO production. Gene expression analysis further demonstrated downregulation of TNF-α and MAPK, with marked suppression of NF-κB transcripts. Collectively, these results provide strong evidence that MCHLE exerts anti-inflammatory activity by targeting both mediator release and upstream signaling pathways, while maintaining a favorable safety profile, supporting its potential as a source of new therapeutic agents.Master Thesis Desenvolvimento de formulações cosméticas contendo sistema multicomponente com ácido ferúlico: caracterização e ensaios in vitro de liberação cutânea(Universidade Federal do Rio Grande do Norte, 2025-09-18) Freire, Jamile Vitória Alves; Lima, Adley Antonini Neves de; Ostrosky, Elissa Arantes; Gomes, Ana Paula Barreto; Baby, André RolimThe cosmetic application of ferulic acid (FA) is limited due to its low solubility in aqueous medium and high susceptibility to oxidation. However, this phenolic compound is widely used because of its recognized antioxidant activity. To overcome these challenges, the multicomponent system Cicloferulic® (CF) was developed, containing FA, hydroxypropyl β-cyclodextrin (HP-β-CD), and polyvinylpyrrolidone K30 (PVP K30), using the kneading method. The system was characterized in terms of physicochemical aspects by DSC and TG/DTG, which showed greater thermal stability of CF compared to isolated FA. FTIR, SEM, and XRD analyses revealed molecular interactions suggesting the formation of the system and the transition from the crystalline to the amorphous state. In in vitro cytotoxicity tests using the human keratinocyte cell line (HaCaT), FA was safe up to a concentration of 500 µg/mL, while CF maintained cell viability above 80% up to 10,000 µg/mL. The quantification of FA content incorporated into the system was performed by UPLC, showing high incorporation efficiency and a yield of 92%. In the antioxidant activity assay in HaCaT cells, FA and CF showed similar activity at low concentrations; however, at higher concentrations, FA exerted a pro-oxidant effect, while CF maintained high antioxidant potential. In the DPPH, ABTS, and CAT methods, CF showed higher antioxidant activity than isolated FA, but in cosmetic formulations such as gel and emulsion, the efficacy was reduced, possibly due to interactions of the complex with the aqueous vehicle. The presence of FA and CF increased the SPF of formulations containing organic UV filters, and the increase was observed similarly even in the formulation with a lower concentration of UV filters; however, the formulations did not remain photostable after irradiation. In in vitro skin release studies, formulations with isolated FA showed greater and faster release, whereas CF promoted slower and modified release, indicating that complexation of the active ingredient and the formulation modulate the availability and flux of FA. Cicloferulic® proved to be a promising strategy to improve the limitations of FA, offering safety, high antioxidant activity, increased SPF, and the possibility of modified release of the cosmetic active ingredient.Master Thesis Peptídeos análogos do TsAP-2: caracterização estrutural, atividade antimicrobiana e associação com fármacos convencionais(Universidade Federal do Rio Grande do Norte, 2025-10-29) Braz, Raiça Dominique Mariana Gomes da Costa; Pedrosa, Matheus de Freitas Fernandes; Inaoka, Daniel Ken; Silva, Teresinha Gonçalves daThe growing resistance of pathogens to conventional antimicrobial agents represents a grave public health issue of global scale. Considering the situation, the need for new therapeutic alternatives is evident. The development of synthetic analogs based on antimicrobial peptides (AMPs) found in nature is a demonstrably promising option. TsAP-A16 and TsAP-A41 are synthetic analogs of TsAP-2, an AMP identified in the venom of the Tityus serrulatus and the Tityus stigmurus scorpions. In vitro and in vivo, TsAP-2 has shown antimicrobial activity against Gram-positive bacteria and Candida spp. yeasts. TsAP-A16 and TsAP-A41 were designed through single replacements on the primary structure of TsAP-2, aiming to obtain molecules more potent than the native peptide. This study focuses on elucidating physicochemical and structural aspects of TsAP-A16 and TsAP-A41, as well as assessing the antimicrobial activity of the peptides in isolation and in combination with conventional drugs, seeking to appraise the potential contributions of TsAP-A16 and TsAP-A41 to the issue of antimicrobial resistance. Bioinformatic tools and in vitro methods were employed in the evaluation of physicochemical characteristics and biological activities of the peptides. In silico data indicate TsAP-A16 and TsAP-A41 as molecules with structural similarities to TsAP-2, but with greater affinity for the Gram-positive and Gram-negative membranes, as demonstrated by molecular dynamics simulations’ results. The analog peptides were obtained through solid phase peptide synthesis prior to investigation of biological activities. In vitro, the analogs demonstrated broadened action spectrum in comparison to TsAP-2, acting not only against Candida spp. and Gram-positive bacteria but Gram-negative strains as well. Preliminary assessment of antifungal molecular mechanisms against Candida albicans revealed affinity of the analog peptides for ergosterol and indifference toward sorbitol, suggesting interactions with components of the fungal cell membrane, but not with the cell wall. Associating the analogs with conventional antibiotics before Staphylococcus aureus e Pseudomonas aeruginosa revealed synergism in combinations with gentamicin, and additive effect in combinations with ceftazidime and penicillin. Assays with murine fibroblasts and human red blood cells indicated concentration-dependent compatibility between the analogs and healthy eukaryotic cells. Furthermore, in silico predictions of the pharmacokinetic and toxicological profiles suggested that the analogs would be well tolerated by the human organism. The data obtained in silico and in vitro corroborate the usefulness of the rational design of molecules derived from scorpion peptides, indicating the peptides TsAP-A16 and TsAP-A41 as promising candidates for the development of new antimicrobial agents.Master Thesis Contribuição ao uso do óleo de urucum no desenvolvimento de fitomedicamentos: avaliação da toxicidade oral aguda do óleo de urucum e caracterização de géis de carbopol contendo nanocarreadores lipídicos e a fração insaponificável de urucum(Universidade Federal do Rio Grande do Norte, 2025-10-30) Bastos, Ana Clara Almeida Santiago; Moura, Túlio Flávio Accioly de Lima e; Rezende, Adriana Augusto de; https://orcid.org/0000-0003-2452-4047; http://lattes.cnpq.br/4245215108740331; http://lattes.cnpq.br/4452581275123481; http://lattes.cnpq.br/8614594182690096; Bezerra, João Felipe; https://orcid.org/0000-0002-9978-628X; http://lattes.cnpq.br/7464620984028550; Ferreira, Leandro De Santis; https://orcid.org/0000-0002-8408-5886; http://lattes.cnpq.br/6622861873027635Bixa orellana L. (urucum) has been highlighted in research aiming to develop herbal medicines due to its wound-healing properties, mainly attributed to various compounds with antiinflammatory and antioxidant action, which favor tissue regeneration. With a view to contributing to the safety of future patients, this work evaluated the acute oral toxicity of formulations with nanoencapsulated urucum oil in Nanostructured Lipid Carriers (NLCs). Additionally, carbopol-based gels containing the NLCs with the unsaponifiable fraction of encapsulated urucum were developed for possible topical application. No behavioral, hematological, or biochemical changes, nor changes in body or organ weights, were found in acute oral toxicity tests in Wistar rats at a dose of 2000mg/kg of the oil. The NLC formulations showed average particle sizes between 106 and 161 nm, a Polydispersity Index (PDI) lower than 0.2, and a zeta potential up to -18 mV, indicating good stability for 90 days. HPLC analysis indicated the presence of tocotrienol in the unsaponifiable fraction of urucum, with a coefficient of determination (R²) of 0.9997, highlighting the adequacy of the model for quantifying the compound in the sample. The formulated hydrogels showed a stable appearance, skincompatible pH, and excellent spreadability, especially in formulations with the unsaponifiable fraction of urucum. Through the collected data, it was possible to confirm that the formulations are safe, stable, and promising for pharmaceutical use, with emphasis on potential topical and wound-healing applications.Master Thesis Obtenção, caracterização físico-química e avaliação biológica in vitro de dispersões sólidas amorfas com a,B-amirenona(Universidade Federal do Rio Grande do Norte, 2024-12-13) Bulhões, Sávio Gorgônio Paes de; Lima, Adley Antonini Neves de; https://orcid.org/0000-0002-3798-3915; http://lattes.cnpq.br/4061809277935577; http://lattes.cnpq.br/3969304016037186; Duarte, Fernanda Ílary Costa; https://orcid.org/0000-0003-2052-9334; http://lattes.cnpq.br/3035470083983748; Rocha, Hugo Alexandre de Oliveira; https://orcid.org/0000-0003-2252-1221; http://lattes.cnpq.br/4651814546820796Obesity is a global public health issue, associated with diets high in fats and carbohydrates, as well as sedentary lifestyles, affecting approximately 25% of the Brazilian population, especially women. Lifestyle changes are the conventional treatment but face adherence challenges, leading to an increased search for medications and surgeries, which come with adverse effects. Triterpenes, such as α,βamirenone (ABAME), have shown antiobesity potential, but their poor water solubility limits their oral effectiveness. To overcome this limitation, solid dispersions (SD) of ABAME were prepared with the polymers PEG and PVP using malaxation (MX) and physical mixing (MF) techniques, aiming to improve solubility and pharmacological properties. The samples were characterized by techniques such as Differential Scanning Calorimetry (DSC), Thermogravimetric Analysis (TG), X-ray Diffraction (XRD), Fourier Transform Infrared Spectroscopy (FTIR), and Scanning Electron Microscopy (SEM), indicating that the interaction between ABAME and the polymers promoted a transition from the crystalline to the amorphous state, as well as greater thermal stability compared to the isolated compound, particularly in the SDs obtained by MX. The quantification of ABAME was performed by High-Performance Liquid Chromatography (HPLC), meeting ANVISA standards and demonstrating success in SD development. In in vitro biological tests, the SDs showed greater efficacy in lipase inhibition compared to isolated ABAME, especially those prepared by MX, with a reduced IC50. Although antioxidant tests showed moderate results, with lower performance in total antioxidant capacity (TAC) and DPPH radical scavenging assessments, the SDs demonstrated excellent reducing power. The data, though preliminary, highlight the antiobesity potential of the SDs, marking them as a promising strategy compared to conventional treatments, which often present adverse effects.Master Thesis Revisão sistemática do potencial efeito da Passiflora edulis no diabetes mellitus(Universidade Federal do Rio Grande do Norte, 2025-07-29) Farias, Luiz Ricardo Teixeira de; Langassner, Silvana Maria Zucolotto; Tavares, Emanuella de Aragão; https://orcid.org/0000-0003-4823-0211; http://lattes.cnpq.br/9967017709735330; https://orcid.org/0000-0002-2768-0793; http://lattes.cnpq.br/7390416147619446; http://lattes.cnpq.br/7649718928075032; Oliveira, Alisson Macário de; https://orcid.org/0000-0003-4152-150X; http://lattes.cnpq.br/1391628714654744; Costa, Geison Modesti; http://lattes.cnpq.br/8830889545657806Diabetes mellitus (DM) is a chronic metabolic disorder of high global prevalence, characterized by hyperglycemia resulting from deficiency in insulin production or action, a condition that leads to progressive dysfunctions in target organs, such as the heart, kidneys, eyes, blood vessels and nervous system. Despite the efficiency of available pharmacological treatments, their adverse effects and therapeutic limitations have driven the search for safe and natural alternatives. In this context, the species Passiflora edulis, widely cultivated in Brazil and traditionally used for the sedative properties of its leaves, has aroused interest regarding the antidiabetic potential of its by-products, especially the peels and seeds, generally discarded by the food industry. This systematic review aimed to evaluate the available in vivo preclinical evidence on the effects of P. edulis in the management of DM. The search was conducted according to the PRISMA guidelines, in the PubMed, Embase and Web of Science databases, and the protocol was registered in the PROSPERO platform (CRD42023472406). Experimental studies with diabetic animal models treated with different preparations of P. edulis were included, and the risk of bias assessment was performed using the SYRCLE RoB tool. Of the 22 eligible studies, 18 reported significant reduction in glycemia, with reductions of up to 71% in glucose levels, both alone and as an adjuvant to insulin. Consistent effects on the modulation of the lipid profile and antioxidant activity were also observed. The barks were the most investigated part of the plant (11 studies), with emphasis on the aqueous extract, whose superiority is attributed to the higher content of bioactive compounds such as pectin, phenols and flavonoids. The proposed mechanisms of action include the reduction of intestinal glucose absorption, stimulation of insulin secretion, partial regeneration of pancreatic β-cells, and activation of relevant metabolic pathways such as PI3K/AKT and AMPK, in addition to antioxidant and hypolipidemic effects. However, important methodological limitations were identified, such as the lack of standardization in the doses used and the scarcity of phytochemical characterization of the extracts, factors that compromise the reproducibility of the findings. Nevertheless, the data suggest that P. edulis barks, due to their high functional value and availability as agro-industrial waste, represent a promising, sustainable and low-cost alternative in the adjuvant treatment of diabetes mellitus and its complications.Master Thesis Parâmetros inflamatórios e fisiopatológicos do envenenamento induzido pelo escorpião Tityus stigmurus em camundongos(Universidade Federal do Rio Grande do Norte, 2016-03-01) Pinheiro, Ilanna Tainá Medeiros Gurgel; Pedrosa, Matheus de Freitas Fernandes; http://lattes.cnpq.br/2929963416385218; http://lattes.cnpq.br/2410445649667950; Freitas, Janaina Cristiana de Oliveira Crispim; https://orcid.org/0000-0002-1344-0078; http://lattes.cnpq.br/2644540835478572; Salvador, Daniela Priscila Marchi; http://lattes.cnpq.br/2247233142415132Scorpion bites are responsible for significant morbidity and pediatric mortality in many parts of the world and represents a public health problem in Brazil. Tityus stigmurus is a scorpion specie of medical importance that occur in the Brazilian Northeast. In this context, this work proposed to analized the inflammatory and pathophysiological parameters after Tityus stigmurus scorpion envenoming in vivo by intraperitoneal injection of 375 µg/kg of venom in BALB/c mice to evaluate its local and systemic effects. For this purpose, the total and differential leukocyte number, myeloperoxidase activity, nitrite levels and total protein were quantified in peritoneal exsudate, as well as, serum biochemical parameters and cytokine (TNF-α and IL-10) levels were analyzed. Alterations in relative organs weight of the experimental animals were also assessed. The results showed that the venom was not able to induce the migration of cells into the peritoneum of experimental animals. However, significant biochemical abnormalities were observed as the increase in CK, CK-MB, AST, ALT, creatinine, amylase, and uric acid. Moreover, it was observed lesions in organs such as heart, liver, kidney and pancreas. It was also demonstrated edema response that was characterized by rapid onset, lasting up to 1 hour. This is the first time that partial characterization of the envenoming induced by T. stigmurus in mice was carried out.Master Thesis O papel dos miRNAs na doença de Lyme: uma revisão(Universidade Federal do Rio Grande do Norte, 2025-06-10) Lavieri, Giovani Jardini; Silbiger, Vivian Nogueira; http://lattes.cnpq.br/6121935907512568; http://lattes.cnpq.br/6121935907512568; http://lattes.cnpq.br/5688094051517300; Ururahy, Marcela Abbott Galvão; https://orcid.org/0000-0003-0229-9416; http://lattes.cnpq.br/8016222352823817; Duarte, Victor Hugo Rezende; https://orcid.org/0000-0002-3122-9073; http://lattes.cnpq.br/5892971598537293Introduction: Lyme disease (LD) is the most common tick-borne disease in North America and Europe. Caused by the bacterium Borrelia burgdorferi, it manifests itself in different forms and stages, and may be asymptomatic or with nonspecific symptoms, in addition to the difficulty in localizing the arachnid bite and the possible lack of formation of erythema migrans, which makes clinical diagnosis difficult. Current laboratory diagnostic methods have limitations, such as the absence of antibodies against bacteria during the first weeks of infection, in addition to access to samples, since Borrelia burgdorferi lodges in difficult-toaccess tissues. In this context, miRNAs emerge as potential candidates in understanding the pathophysiology of LD, as well as biomarkers and therapeutic targets, given their stability and ability to reflect pathological states, including bacterial infections. Objective: To conduct a narrative review on the role of miRNAs in LD. Methodology: The search was performed in PubMed, Embase, ScienceDirect, Web of Science and LILACS databases, using the terms "Lyme Disease", "Borrelia burgdorferi", "Lyme Borreliosis", "Lyme Arthritis", "Lyme Carditis" and "MicroRNA". Results: Of the 7 studies included, three were performed in vitro with different human cell cultures, two used in vivo models with mice, one study was performed in vitro with Ixodes scapularis ticks and one was observational with patient samples. Total RNA extraction methodologies varied between the TriZol method and the miRNeasy Kit and the analysis of miRNA expression varied from RNAseq to qRT-PCR. In total, 261 differently expressed miRNAs were analyzed among all studies and, of these, miR-146a-5p, miR-155, miR-145 and miR-146b were described in more than one study with increased expression in different samples and clinical manifestations. Conclusion: miRNAs such as miR-146a-5p, miR-155, miR-145, and miR-146b play important roles in the inflammatory regulation of LD, being involved in dermal manifestation, arthritis, carditis, and microglial activation. These miRNAs have potential as biomarkers and therapeutic targets in LD, although further studies are needed to validate their applicability in the diagnosis and treatment of the disease.Master Thesis Identificação do Trypanosoma cruzi por amplificação do DNA com novos iniciadores na Reação em Cadeia da Polimerase (PCR)(Universidade Federal do Rio Grande do Norte, 2025-01-28) Sales, Leticia Mikardya Lima; Câmara, Antonia Cláudia Jácome da; Galvão, Lucia Maria da Cunha; https://orcid.org/0000-0002-6207-4502; http://lattes.cnpq.br/6437957961133013; https://orcid.org/0000-0001-7337-9320; http://lattes.cnpq.br/5445255186647578; https://orcid.org/0000-0002-9809-6658; http://lattes.cnpq.br/4167228218023419; Rodrigues Neto, João Firmino; http://lattes.cnpq.br/6168035663769198; Silva, Eliane Lages; http://lattes.cnpq.br/9387494555377448Chagas disease (CD) is a parasitic infection caused by the flagellated protozoan Trypanosoma cruzi. The diagnosis of the chronic phase of Chagas disease is performed mainly by serological tests, which detect specific anti-T. cruzi antibodies. However, inconclusive or false-positive results are recurrent, mainly due to crossreactions with other trypanosomatids. Thus, advances in molecular biology are responsible for significantly improving the diagnosis of the infection. The objective of this study was to identify T. cruzi from different Discrete Typing Units (DTUs) by DNA amplification with new primers in the Polymerase Chain Reaction (PCR). Primer design was based on DNA sequences of T. cruzi reference strains, clones and isolates deposited in NCBI GenBank for the kDNA genes: 18S, Cytochrome Oxidase subunit II (COX II), NADH dehydrogenase subunit 1 (NADH 1) and NADH dehydrogenase subunit 5 (NADH 5). Primers were designed in NCBI Primer-Blast. After manual checking and in silico testing, the most promising primers designed for the 18S gene (5’ – CAAGCGGCTGGGTGGTTATT – 3’ and 3’ – CACGGATTTCCCACAAAGGC – 5’) produced a 104bp fragment, COX II (5’ – TGTTATCCATTCATTTACGTTAGC – 3’ and 3’ – CATAACTCGCTGCATTGC – 5’) produced a 122bp fragment, NADH 1 (5’ – AAGTCCAGCAACCAATTCACTT – 3’ and 3’ – CGTTACTCTGTGATGGCTTGA – 5’) formed a 71bp band and NADH 5 (5’ – AGAGTACACAGTTTGGGTTG – 3’ and 3’ – CCACATACAACTAACGTTGC – 5’), which produced a 100bp band were selected for the study. Initially, the PCR conditions were tested for the four chosen primer pairs and the annealing temperatures were defined as 60ºC (18S), 48ºC (COX II), 57ºC (NADH 1) and 55ºC (NADH 5). Then, the analytical sensitivity test was performed with different DTUs, DNA concentrations and amount of the parasite in the blood. The primers designed for 18S detected the parasite at concentrations of 0.1fg to 1000fg in TcI (Col 1.7), 1fg to 1000fg for TcII (Y) and 10fg to 1000fg in TcIII (CBS56). The analytical sensitivity of the parasite concentration in the blood revealed that the 18S primers were able to detect T. cruzi DNA at concentrations of 1000p/mL in TcI and TcII samples; and from 10pmL to 1000p/mL in TcIII. The COXII PCR did not achieve adequate standardization. The primers used for the NADH 1 and NADH 5 PCR were not able to detect all the DTUs tested. The data presented here revealed that the identification of T. cruzi was not very efficient in human blood samples from domesticated animals such as Canis familiaris, Ovis aries and Capra hircus. Furthermore, parasite DNA was identified in all T. cruzi samples from cultures of intestinal contents of triatomines.Master Thesis Investigação fitoquímica e avliação do potencial efetivo antiviral e da toxicidade oral aguda de Scoparia dulcis L. (Vassourinha)(Universidade Federal do Rio Grande do Norte, 2020-09-18) Jales, Francisco Leandro Medeiros de Lucena; Langassner, Silvana Maria Zucolotto; Pedrosa, Matheus de Freitas Fernandes; http://lattes.cnpq.br/2929963416385218; https://orcid.org/0000-0002-2768-0793; http://lattes.cnpq.br/7390416147619446; Araújo, Joselio Maria Galvão de; https://orcid.org/0000-0003-3548-2786; http://lattes.cnpq.br/6430774978643765; Fernandes, Júlia Morais; https://orcid.org/0000-0001-9769-5352; http://lattes.cnpq.br/8060189333626922The species Scoparia dulcis L. (Plantaginaceae), commonly known as broom, is popularly used as a healing, anti-inflammatory and in the treatment of gastrointestinal diseases. The main secondary metabolites described for the speciesare terpenes such as scopadulcic acids A and B, scopadiol, scopadulciol, scopadulinic, scoparic acids A - C, but there are also reports of the presence of flavonoids. The present study aimed to investigate the phytochemical profile and evaluate the antiviral potential and toxicity of the extract of the leaves of S. dulcis. Four hydroethanolic extracts were prepared from the urban area of the city of Natal,and only one extract produced from the collection carried out in the rural area of thecity of Serra CaiadaRN, with variation in the method of extraction and alcohol content: maceration 35%, and 70% and 35% and 70% turbolysis. The extracts wereanalyzed by Thin Layer Chromatography and Liquid Chromatography coupled to a mass spectrometer and the content of total flavonoids and phenols was observed. The extracts obtained from samples from the urban area were subjected to non- clinical in vitro cytotoxicity tests, through the evaluation of cell viability in Vero cells by the MTT assay, and of antiviral activity against Herpes virus type 1 and antiviral activity against the herpes virus type I- (HSV-1) in the tests: virucidal activity, post- infection, concomitant and pretreatment. The acute oral toxicity of the extract obtained by macerating 70% of samples collected from the rural area of Serra Caiada was evaluated in an in vivo model, by oral administration of 2000 mg / kg. 31substances in S. dulcis extracts, mostly flavonoids such as quercetin-derived O- glycosides, in addition to benzyl alcohol, benzoic acid methyl ester, palmitic acid methyl ester, oleic acid methyl ester, phytol acid methyl ester, methyl ester stearic acid, n-tetracosane and five more compounds with a fragmentation profile similar toterpenes have been described for the species. As for the content of total phenols and flavonoids, the extracts that presented the highest content were: turbolysis 70%urban area with 104.18 ± 0.05 for phenols and 64.06 ± 0.05 for flavonoids and maceration 70% rural area, with 98.04 ± 0.03 and 56.75 ± 0.06. There was a cell viability above 80% for all extracts from the urban zone up to a concentration of 250µg / mL, with the exception of the extract obtained by 35% turbolysis, which presented cell viability below 50%. In the studied antiviral models, the extract obtained by turbolysis 70% proved to be the most efficient when compared to the other extracts, since it promoted a significant inhibition of the HSV-1 virus. Regardingthe assessment of acute toxicity in vivo of the extract obtained by maceration 70% (rural sample), no changes were observed in the biochemical, behavioral or hematological parameters that were suggestive of toxicity generated by the extract in the evaluated / tested concentration. Finally, the species showed a potential antiviral effect in vitro and showed no signs of toxicity in vitro and in an acute modelin vivo.Master Thesis Desenvolvimento da pré-eclâmpsia e o gene STOX1: uma revisão sistemática e metanálise(Universidade Federal do Rio Grande do Norte, 2025-06-03) Paiva, Beatriz Maia de; Ururahy, Marcela Abbott Galvão; https://orcid.org/0000-0003-0229-9416; http://lattes.cnpq.br/8016222352823817; http://lattes.cnpq.br/8771590623106854; Sarmento, Ayane Cristine Alves; https://orcid.org/0000-0001-9131-1952; http://lattes.cnpq.br/6145665770763582; Souza, Karla Simone Costa de; https://orcid.org/0000-0002-8541-1444; http://lattes.cnpq.br/2262063068881600Preeclampsia (PE) is a multifactorial hypertensive disorder of pregnancy and a major cause of maternal and perinatal morbidity and mortality worldwide. Polymorphisms in the STOX1 gene (Y153H and -922 T>C) have been associated with susceptibility to PE, but findings remain inconsistent. Thus, the objective of this study was to assess the association between STOX1 gene polymorphisms and the development of PE through a systematic review and meta-analysis. This review followed the PRISMA guidelines and was registered in PROSPERO (CRD42023465306). A search was conducted in eight databases to identify studies investigating STOX1 gene polymorphisms in pregnant women with PE versus normotensive controls. Observational studies with no restrictions on date or language were included, provided they involved women with PE and STOX1 polymorphisms. Two reviewers independently selected and extracted the data, and a third reviewer was consulted in cases of discrepancies or conflicts. Methodological quality was assessed using the Newcastle-Ottawa Scale (NOS). Pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using fixed or random-effects models, depending on heterogeneity assessed by the I² statistic. A total of 300 studies were retrieved from the databases, and after the selection process, four were included, comprising 1,906 cases and 3,019 controls. Three studies investigated the Y153H variant and found no significant association with PE. The meta-analyses showed high heterogeneity, especially in the allele comparison (I² = 99.6%). Only one study assessed the -922 T>C polymorphism and found a significant association with PE, particularly early-onset PE (OR = 2.01; 95% CI [1.11–3.65]; p = 0.02); however, it was not included in the meta-analysis due to the lack of comparable studies. The included studies had good methodological quality, scoring 7 stars on the NOS. No consistent evidence was found that the STOX1 Y153H polymorphism is associated with PE. Although some studies suggest an association with PE, a comparative consistency analysis could not be performed. Larger, multiethnic studies including clinical, genetic, and transcriptomic data are needed to elucidate the role of STOX1 in the pathogenesis of PE.Master Thesis Coencapsulação de Lactiplantibacillus plantarum e compostos bioativos extraídos do jambolão (Syzygium cumini)(Universidade Federal do Rio Grande do Norte, 2025-03-31) Dantas, Lívia Maria da Costa; Sousa Júnior, Francisco Canindé de; Assis, Cristiane Fernandes de; https://orcid.org/0000-0003-2042-4348; http://lattes.cnpq.br/3721560802857426; http://lattes.cnpq.br/9945599530267245; Araújo, Nathalia Kelly de; Passos, Thais SouzaProbiotics combined with plant extracts hold great potential for co-microencapsulation to promote synergistic effects. Jambolan (Syzygium cumini) fruit is a rich and low-cost source of phenolic compounds and anthocyanins. The present study aimed to comicroencapsulate Lactiplantibacillus plantarum NRRL B-4496 and jambolan fruit extract (JE) by complex coacervation. Phenolic compounds were extracted from jambolan fruit using methanol, and the solvent was removed by rotary evaporation followed by freeze-drying. Microcapsules containing L. plantarum and 0% (ME-0%), 1% (ME-1%), or 5% (ME-5%) jambolan extract were produced by complex coacervation at pH 3.0, using a combination of arabic gum, soy protein isolate, and soy oil. A control microcapsule system was also prepared by coacervation at pH 4.5. Incorporation of JE significantly enhanced the encapsulation efficiency (EE) of L. plantarum in the freeze-dried forms, increasing from 57.45% in ME-0% (pH 3.0) to 74.84% in ME-1% and 71.16% in ME-5%. The EE of anthocyanins was 60.29% for ME-1% and 60.84% for ME-5%. Fourier-transform infrared spectroscopy (FTIR) confirmed the stability of the molecular structures, while X-ray diffraction (XRD) revealed increased crystalline peaks for ME-1% and ME-5%. Additionally, both jambolan extract and the ME-1% formulation exhibited no cytotoxic effects. These findings support the potential of using plant-based encapsulating materials to coencapsulate L. plantarum and jambolan extract by complex coacervation, offering a promising approach for the development of novel vegan multifunctional probiotic products.Master Thesis Nanoemulsões contendo fitol como alternativa farmacológica para o tratamento da leishimaniose cutânea(Universidade Federal do Rio Grande do Norte, 2022-12-12) Freire, Victoria Louise Pinto; Silva Júnior, Arnóbio Antonio da; Silva, Marcelo de Sousa da; https://orcid.org/0000-0002-7516-1787; http://lattes.cnpq.br/2593509584288129; http://lattes.cnpq.br/8701522182756219; Andrade Neto, Valter Ferreira de; Oliveira, Douglas Dourado; Nascimento, Ednaldo Gomes doLeishmaniasis is considered one of the main neglected diseases in the world, with large numbers of cases annually, it is caused by protozoa of the genus Leishmania spp. and affects mainly populations in poorer countries. The treatment of the disease is very limited, toxic to the patient, high cost and the parasite is resistant to chemotherapy. In this way, trying to solve problems such as the side effects of drugs already in use, reducing drug resistance and improving existing treatments, pharmaceutical nanotechnology appears with drug delivery systems on a nanometric scale, as is the case of nanoemulsions (NE). At the same time, alternative leishmanicidal active principles have been sought to treat the disease, such as phytol, which is a component of chlorophyll from the diterpene class, which is found abundantly in nature and has a wide range of proven biological activities. Thus, the present study aims to develop NE containing biocompatible phytol by the phase inversion emulsification technique, to evaluate the effect of the composition on the physical-chemical parameters of the nanoemulsions, to observe the long-term and accelerated stability of the systems obtained with and without the active one, also observe the cytocompatible profile in 3T3 cells, the hemolytic potential in erythrocytes and the in vitro capacity of these antileishmanial systems. Thus, it was observed that the EN developed were stable for up to 30 days and under high stress conditions with centrifugations at high rotations showing adequate macroscopic and physical-chemical parameters. A cytocompatible profile was also observed at up to 70% in the concentrations tested with the cell line tested and in the hemolysis assay only showed hemolysis in the initial concentrations, suggesting safety for administering the system in an in vivo study. It was also observed that the developed EN had a good and timedependent activity. Therefore, the NE produced proved to be a promising drug for the treatment of cutaneous leishmaniasis, proving to be safe and effective.Master Thesis Identificação molecular, caracterização dos fatores de virulência e perfil de susceptibilidade antifúngica de isolados de Trichosporon spp(Universidade Federal do Rio Grande do Norte, 2022-12-21) Jimenez, Márcia Gabriele de Souza; Chaves, Guilherme Maranhão; https://orcid.org/0000-0002-0170-9383; http://lattes.cnpq.br/1463249528959656; http://lattes.cnpq.br/2621755476353143; Andrade, Vânia Sousa; Guerra, Felipe Queiroga SarmentoYeasts belonging to the genus Trichosporon emerge as emerging pathogens with high mortality rates. Primarily, Trichosporon species are etiological agents of white piedra, a fungal infection characterized by nodules adhered to the extrafollicular region of the hair shaft. However, in recent decades, Trichosporon spp. have been considered opportunistic pathogens responsible for severe communities. The number of researches involving the genus Trichosporon is still scarce, with little information available on the profiles of sensitivity to antifungal agents, expression of virulence factors “in vitro” and the actual distribution of the species in the different sites of infection. The objectives of this study were to carry out a molecular identification (IGS1 region of the rDNA) of Trichosporon spp. transmitted from white “piedra”, as well as determining the expression of “in vitro” virulence factors, including: DNases, hemolysins and phospholipases activity, ability to adhere to epithelial cells, cell surface hydrophobicity, melanin and biofilm production, in addition to evaluating fungal growth in the presence of cellular stressors. Also determine the antifungal susceptibility profile of clinical isolates of Trichosporon spp. and the results were compared to systemic infection strains. We identified 4 T. asahii isolates, 17 T. inkin isolates, 2 T. faecale and 2 T. asteroides isolates. Phylogenetic analysis revealed a higher degree of genetic relatedness (high bootstrap value) between T. asahii, T. asteroides and T. faecale, with T. inkin being considered a less closely related species. T. inkin isolates were more prevalent in clinical samples from patients with white piedra, in addition to showing greater ability to adhere to epithelial cells. The T. asahii isolates showed higher capacity for biofilm formation, cell surface hydrophobicity and hemolytic index. All evaluated isolates were able to produce hemolysins and DNases, whereas melanin production in Niger Seed Agar was not detected. Phospholipase production was negative for all tested isolates, except for two strains of T. inkin, which showed a high Pz value (low enzyme production). Several isolates considered minimal inhibitory concentrations and high epidemiological cut-off values, with a tendency to multidrug resistance to azoles (ketoconazole, itraconazole and fluconazole) and amphotericin B. Although the present study included few T. asahii isolates, they were captured this species, in general, stands out in the expression of virulence factors and resistance to antifungal agents, reinforcing its importance in invasive trichosporonosis.Master Thesis Síntese, caracterização e avaliação antimalárica de 1H-1,2,3- triazóis-1,4-dissubstituídos derivados da melatonina e triptamina(Universidade Federal do Rio Grande do Norte, 2025-04-08) Carlos I, Lamark; Jordão, Alessandro Kappel; Barbosa, Euzébio Guimarães; https://orcid.org/0000-0002-2920-3966; http://lattes.cnpq.br/2003461080025290; http://lattes.cnpq.br/7383298963997867; Menezes, Fabricio Gava; Fernandes, Thales Allyrio Araújo de MedeirosPresent in more than 90 countries, malaria is considered one of the most lethal infectious diseases in the world. Caused by parasites of the Plasmodium genus, it is transmitted by female Anopheles mosquitoes. The most recent data on the epidemiology of the disease released by the World Health Organization (WHO) estimate that in 2023 there were approximately 263 million cases of malaria worldwide, with more than 597,000 deaths. The search for new compounds with antimalarial activity is urgent, since resistance to the classic drugs used for treatment has already been described in countries where the disease is endemic. Melatonin is a hormone with an indole structure and plays a central role in controlling the replication of the parasite that causes malaria and stabilizing parasitemia. Blocking the pathway of this hormone may contribute to the discovery of new antimalarial drugs. The aim of this work was to prepare triazoles derived from the indole nucleus that may exhibit antimalarial activity on the parasite cell cycle, inhibiting the growth or causing the death of Plasmodium falciparum. Several novel molecules containing in their structure, heterocyclic 1H-1,2,3-triazole rings and benzene ring with different substituents were designed and synthesized in this work by means of the CuAAC “click chemistry” reaction catalyzed by copper (I). In the synthesis step, the melatonin precursor was subjected to the alkylation reaction to form the respective terminal alkyne intermediate (3). Subsequently, this intermediate was treated with different prepared aromatic azidocompounds (1a-e) to form the respective triazole products of the series (4a-e) derived from melatonin with yields ranging from 68 to 91%. Tryptamine, a congener of melatonin, was also used as a precursor in the formation of triazole sulfonamide compounds of the series (8a-e) and (11a-e) with yields ranging from 59.4 to 91%. The structural elucidation of the intermediates and products obtained was successfully performed using IR and NMR spectroscopic techniques of 13C and 1H isotopes. Compounds (10), (4d) and (4e) exhibited measurable antimalarial activity with IC50 values of 33.38 ± 1.487 µM, 31.92 ± 6.370 µM and 11.57 ± 1.863 µM, respectively, showing low cytotoxicity in mammalian cells. Among these, (4e) emerged as the most potent and least cytotoxic with SI (>4.32). These results highlight the potential of these three compounds as promising candidates for further investigation, providing a solid basis for future studies aiming at their optimization and development as antimalarial agents.Master Thesis Caracterização físico-química, citotoxicidade e propriedades bioativas do óleo da castanha de sapucaia (Lecythis pisonis)(Universidade Federal do Rio Grande do Norte, 2025-03-31) Santos, Júlia da Costa; Sousa Júnior, Francisco Canindé de; Assis, Cristiane Fernandes de; https://orcid.org/0000-0003-2042-4348; http://lattes.cnpq.br/3721560802857426; http://lattes.cnpq.br/6489481856774447; Matsui, Katia Nicolau; Oliveira Júnior, Sérgio Dantas deLecythis pisonis, popularly known as sapucaia, is a plant species widely distributed in Brazil. Its seeds, leaves and stem are traditionally used to treat diabetes, coughs, muscle pain and itching, among other conditions. The aim of this study was to evaluate the physicochemical characteristics, cytotoxicity, and bioactive properties of sapucaia nut oil. The oil was characterized using the proton nuclear magnetic resonance and gas chromatography coupled with mass spectrometry, revealing a high content of unsaturated fatty acids, especially linoleic (53%) and oleic (25%) acids. Additionally, the characterization included Fourier transform infrared spectroscopy (FTIR) and the evaluation of physical-chemical parameters such as moisture, acidity, peroxide, saponification, iodine and density, all of which confirmed the presence of unsaturated fatty acid chains and attested to the quality of the oil. Moreover, thermogravimetric analysis (TG/DTA) indicated high thermal stability, with decomposition starting at 288 °C. No cytotoxic activity was found in CHO-K1 (Chinese hamster ovary) and HepG2 (human hepatocarcinoma) cells. The oil had a total phenolic concentration (TPC) of 291.77 µg EAG.g-1 and showed antioxidant activity against ABTS radicals (2,2'- azinobis 3-ethylbenzothiazoline-6-sulfonic acid) of 4.28 µmol TE.g-1 and DPPH (2,2- diphenyl-1-picrylhydrazyl) of 14.84 mMol TE.g-1. The total antioxidant capacity (CAT) of the methanolic fraction of the oil was 20.51 mg AA.g-1. Sapucaia nut oil also demonstrated in vitro inhibitory capacity against the enzymes involved in carbohydrate digestion - α-amylase (94.01%), α-glucosidase (98.03%) and amyloglucosidase (84.88%) – and exhibited antifungal activity against Candida albicans with a minimum inhibitory concentration of 10 mg/mL. The results of this study contribute to a better understanding of the physicochemical characteristics, biological activities, and potential applications of sapucaia oil, aiming to disseminate knowledge and encourage interest in the food, pharmaceutical and cosmetics industries. Futhermore, the study seeks to enhance the value of the production chain, boost the local economy, and promote the preservation of the species, thereby generating income opportunities for the producing regions.Master Thesis Nanoemulsões contendo coenzima Q10 e resveratrol como potencial estratégia para o tratamento de hiperpigmentação cutânea induzida por quimioterapia(Universidade Federal do Rio Grande do Norte, 2024-12-20) Pereira, Eron Lincoln Alves; Silva Júnior, Arnóbio Antonio da; Medeiros, Thayse Silva; https://orcid.org/0000-0002-7516-1787; http://lattes.cnpq.br/2593509584288129; http://lattes.cnpq.br/9933241126257479; Araújo, Aurigena Antunes de; Formiga, Fábio RochaCancer is a highly prevalent and incident disease worldwide, with treatments that, while essential, often involve significant toxicity, including adverse effects such as cutaneous hyperpigmentation. To manage this adverse effect, depigmenting agents with antioxidant activity and/or tyrosinase-inhibiting properties, such as coenzyme Q10 (CoQ10) and resveratrol (RSV), are commonly employed. However, these molecules present biopharmaceutical challenges, including low aqueous solubility, poor permeability, and chemical instability. In this context, the use of nanoemulsion systems emerges as a valuable strategy to improve formulations and overcome these limitations. In the present study, nanoemulsions containing CoQ10 and RSV were developed using the phase inversion composition technique and characterized in terms of hydrodynamic diameter, polydispersity index (PDI), zeta potential, pH, infrared spectroscopy, transmission electron microscopy, and rheology. The characterization revealed nanoscale droplets ranging from 110 to 250 nm in size, spherical in shape, with uniform distribution (PDI < 0.3) and anionic surface charge. Rheological analysis demonstrated that the viscosity of the oil phase influences the system's formation. Antioxidant profile studies showed that the nanoemulsion systems could maintain or enhance the in vitro antioxidant capacity of the active compounds. Furthermore, the formulations were evaluated for safety, with haemolytic potential and cell viability tests confirming the cytocompatibility of the systems. Thus, the developed systems were successfully characterized and tested, demonstrating satisfactory activity and safety.Master Thesis Avaliação antiviral in vitro de novos sistemas de liberação com derivado naftoquinona(Universidade Federal do Rio Grande do Norte, 2025-01-31) Góes Neto, Gilson Cassiano de; Lima, Ádley Antonini Neves de; Oliveira, Veronica Da Silva; http://lattes.cnpq.br/4847921230270944; Formiga, Fábio Rocha; Silva, Marcelo de Sousa daThe outbreak of dengue fever, a disease transmitted by the DENV virus, has spread globally, causing millions of deaths worldwide. Therefore, it is necessary to develop new compounds that can act in the treatment of dengue fever. Naphthoquinones (NQs) and their derivatives have antifungal, antiparasitic and antimicrobial action, among which is the compound IVS320, a molecule with promising antimicrobial action, but with low solubility. Cyclodextrins (CDs) are used as a strategy to improve the solubility, stability and bioavailability of drugs. In this context, the development of inclusion complexes (ICs) with cyclodextrins can solve the implicit restrictions of IVS320, and in turn, increase its bioavailability and pharmacological action. Thus, the present study aims to improve the physicochemical and biological properties of naphthoquinone IVS320, through the development of inclusion complexes. In addition to evaluating the in vitro anti-DENV activity of the obtained delivery systems and analyzing the bioactive potential of the compound, the complexes obtained with γ-CD, HP-γ-CD and HP-β-CD, through the physical mixing ( MF), kneading (ML) and rotary evaporation (RT) techniques, were characterized by XRD, FTIR, DSC and TG techniques. The XRD results of the isolated IVS320 exhibited crystalline reflections with high intensity at 10°, 18°, 32° and 37°, while the diffractograms of the MF, ML and RT systems showed a reduction in the crystalline profile, suggesting the formation of complexes . The FTIR spectra of the systems bands showed characteristic of both IVS320 and the CDs employed, with modifications in the profile of some bands. In turn, the DSC showed little similarity with the endothermic and exothermic events observed in the isolated IVS320, and the IC exhibited the main occurrences in the ranges of 70-80°C, 190-200°C, up to exothermic peaks in the range of 250°C-260°C, signaling crystallization. While in the TG, well-defined stages of mass loss were observed for all complexation techniques, in which the first events of the systems occurred around 50°C to 70°C, with approximately 10% mass loss, while the second variation began between 300 and 340°C, followed by gradual mass decay up to 600°C, with the highest ∆m (approximately 80%). Regarding in vitro activity, the compound IVS320 presented quite satisfactory results, being able to inhibit the DENV virus. The results of the physicochemical characterization indicated the formation of IVS320 ICs with CDs, demonstrating that the methods employed were effective and that the systems developed are promising for enhancing the antiviral activity of IVS320. The antiviral activity against DENV-2 was evaluated and the antiviral cytotoxicity assays demonstrated that the ICs were able to protect healthy human cells against the pathogen, suggesting that the complexes are more toxic to the virus cells than to human cells.Master Thesis Caracterização física e avaliação in vivo de um scaffold de hidroxiapatita/nióbio(Universidade Federal do Rio Grande do Norte, 2024-12-27) Silva, Salomé Ribeiro da; https://orcid.org/0000-0001-9264-4695; http://lattes.cnpq.br/3531154240424211; http://lattes.cnpq.br/7110960761046943; Chaves, Hellíada Vasconcelos; Farias, Naisandra Bezerra da SilvaHydroxyapatite (Hap) is a highly trained compound used for clinical use, due to the treatment of a mineral component present in the formation of bones, its use provides conditions for bone growth, thus allowing the biological fixation of grafts that are widely used for reconstructions of organic tissues, very little progress has been made in relation to materials capable of fulfilling with excellence the function of a material that is capable of having an osseointegration characteristic, in this sense the search for new constituent elements of the grafted pieces appears as a motivation of studies, as it provides the patient with an option to choose their treatments. In this sense, a Hydroxyapatite/Niobium compound was considered as a bioceramic material, it was characterized in terms of its morphology [X-ray diffraction (XRD), tension, cracking and tenacity and analyzed in vivo in a skullcap model with 8 mm critical defect performed in Wistar rats, with 3 experimental groups: Control (GC) - (positive control); Hap (hydroxyapatite standard) and (CNb/CPO - Hydroxyapatite/Niobio). After 90 days, the animals were euthanized and the samples were evaluated using Micro CT, HE and immunohistochemistry. The data obtained were statistically evaluated using the ANOVA test and the results were: In the mechanical results of XRD, the presence of hexagonal crystalline Hap and a P63/m space group was observed in the pure sample, while in the group with Nb, the presence of β-tricalcium phosphate (Ca3(PO4)2) and Fersmite (CaNb2O6), which may be related to the decomposition of Hap in the presence of Nb. In the XRF analysis, results close to those of grinding were obtained, proving that the technique used was efficient. Regarding the presence of indentations and cracks, there was a small increase in fracture toughness from Hap (0.78 MPa.m1/2) to Hap/Nb (0.82 MPa.m1/2). As in vivo results: micro-CT showed an increase in trabecular number (p˂0.001), a decrease in porosities (%) (p˂0.001) and a decrease in trabecular separation (mm) (p˂0.001) in the CNb/CPO group in comparison to the CG group. In the CNb/CPO group, there was the presence of new bone in which the connective tissue differentiates to form or indicate a bone matrix score of 3 (3-3.75, p˂0.05) and strong immunoexpression of osteopontin (p<0, 05). The results indicate that CNb/CPO showed resistance to crack propagation and stimulated bone formation in calvarial defects in rats.